miRmap REST help

With the miRmap web REST API, you can:

• Choose the source of predictions (species and miRmap run),
• Download pre-computed miRmap predictions,
• Predict miRNA targets with miRmap on your own sequences.

Result is returned as a JSON string with the following format:

{"items": [{"id": int,
           "description": string,
           "url_gene": string,
           "name": string},
           ... ],
 "totalCount": int}

wget https://mirmap.ezlab.org/remote/run

wget https://mirmap.ezlab.org/remote/run?query=human

The main query (below) requires a gene and/or a miRNA ID that can be obtained with the following queries.

Result is returned as a JSON string with the following format:

{"items": [{"id": int,
           "name": string},
           ... ],
 "totalCount": int}

Result is returned as a JSON string with the following format:

{"items": [{"id": int,
           "name": string,
           "names": [string],
           "description": string},
           ... ],
 "totalCount": int}

The main query.

{"queries":[{"run":<id>,
             "mirna":<id|null>,
             "gene":<id|null>},
             ...],
 "valuesFormat":"<percentile|raw>",
 "valuesLevel":"<pair|site>",
 "withSequence":<true|false>,
 "format":"<json|csv>"}

Result is returned as a JSON or CSV string. Column order for CSV is the same as JSON format.

{"items": [[run_id, mirna_id, mirna_mature_name, mirna_seq, transcript_id, transcript_stable_id, transcript_canonical, utr3_seq, transcript_chr, transcript_strand, gene_stable_id, name, site_end, site_chr_end, seed_length, tgs_au, tgs_position, tgs_pairing3p, dg_duplex, dg_binding, dg_duplex_seed, dg_binding_seed, dg_open, dg_total, prob_exact, prob_binomial, cons_bls, selec_phylop, mirmap_score],
           ... ],
 "totalCount": int}

wget "https://mirmap.ezlab.org/remote/mirna?run=1&query=let-7e-3p"

wget "https://mirmap.ezlab.org/remote/gene?run=1&query=NUP37"

wget --post-data='json_request={"queries":[{"run":1,"mirna":11028,"gene":11965}],"valuesFormat":"percentile","withSequence":false,"format":"csv"}' https://mirmap.ezlab.org/remote/db

wget --post-data='json_request={"queries":[{"run":1,"mirna":11028,"gene":null}],"valuesFormat":"percentile","withSequence":false}' https://mirmap.ezlab.org/remote/db

To predict the targets on a gene or a miRNA from the database (not your own), use the corresponding id, as shown in the previous section.

{"queries":[{"run":<id>,
             "mirna":<id>,
             "gene":<id>,
             "mirna_seq":<sequence>,
             "gene_seq":<sequence>},
             ...],
 "valuesFormat":"<percentile|raw>",
 "valuesLevel":"<pair|site>",
 "format":"<json|csv>"}

Result has the same format as database interrogation (/remote/db); please see above.

wget --post-data='json_request={"queries":[{"run":1,"mirna_seq":"CUAUACGGCCUCCUAGCUUUCC","gene":11965}],"valuesFormat":"percentile","withSequence":false}' https://mirmap.ezlab.org/remote/mirmap