miRmap REST help
Comprehensive prediction of microRNA target repression strength
miRmap web REST API

With the miRmap web REST API, you can:

  • Choose the source of predictions (species and miRmap run),
  • Download pre-computed miRmap predictions,
  • Predict miRNA targets with miRmap on your own sequences.
Listing miRmap prediction sets
Query
QueryURLParameterRequiredDescription
GET/remote/runqueryNoSearch-key for run names.

Result is returned as a JSON string with the following format:

{"items": [{"id": int,
           "description": string,
           "url_gene": string,
           "name": string},
           ... ],
 "totalCount": int}
Examples
wget http://mirmap.ezlab.org/remote/run
wget http://mirmap.ezlab.org/remote/run?query=human
Querying miRmap prediction sets
Queries

The main query (below) requires a gene and/or a miRNA ID that can be obtained with the following queries.

QueryURLParameterRequiredDescription
GET/remote/mirnarunYesmiRmap run ID (see above).
queryNoSearch-key for miRNAs.

Result is returned as a JSON string with the following format:

{"items": [{"id": int,
           "name": string},
           ... ],
 "totalCount": int}
QueryURLParameterRequiredDescription
GET/remote/generunYesmiRmap run ID (see above).
queryNoSearch-key for genes.

Result is returned as a JSON string with the following format:

{"items": [{"id": int,
           "name": string,
           "names": [string],
           "description": string},
           ... ],
 "totalCount": int}

The main query.

QueryURLParameterRequiredDescription
POST/remote/dbjson_requestyesJSON-formatted query.
{"queries":[{"run":<id>,
             "mirna":<id|null>,
             "gene":<id|null>},
             ...],
 "valuesFormat":"<percentile|raw>",
 "valuesLevel":"<pair|site>",
 "withSequence":<true|false>,
 "format":"<json|csv>"}
With the percentile option, the raw values are scaled from 0 to 100. With the pair option, one prediction per (miRNA,mRNA) pair is returned. All target sites are returned with site option.

Result is returned as a JSON or CSV string. Column order for CSV is the same as JSON format.

{"items": [[run_id, mirna_id, mirna_mature_name, mirna_seq, transcript_id, transcript_stable_id, transcript_canonical, utr3_seq, transcript_chr, transcript_strand, gene_stable_id, name, site_end, site_chr_end, seed_length, tgs_au, tgs_position, tgs_pairing3p, dg_duplex, dg_binding, dg_duplex_seed, dg_binding_seed, dg_open, dg_total, prob_exact, prob_binomial, cons_bls, selec_phylop, mirmap_score],
           ... ],
 "totalCount": int}
Examples
wget "http://mirmap.ezlab.org/remote/mirna?run=1&query=let-7e-3p"
wget "http://mirmap.ezlab.org/remote/gene?run=1&query=NUP37"
wget --post-data='json_request={"queries":[{"run":1,"mirna":11028,"gene":11965}],"valuesFormat":"percentile","withSequence":false,"format":"csv"}' http://mirmap.ezlab.org/remote/db
wget --post-data='json_request={"queries":[{"run":1,"mirna":11028,"gene":null}],"valuesFormat":"percentile","withSequence":false}' http://mirmap.ezlab.org/remote/db
Predicting miRNA targets with miRmap
Description

To predict the targets on a gene or a miRNA from the database (not your own), use the corresponding id, as shown in the previous section.

QueryURLParameterRequiredDescription
POST/remote/mirmapjson_requestyesJSON-formatted query.
{"queries":[{"run":<id>,
             "mirna":<id>,
             "gene":<id>,
             "mirna_seq":<sequence>,
             "gene_seq":<sequence>},
             ...],
 "valuesFormat":"<percentile|raw>",
 "valuesLevel":"<pair|site>",
 "format":"<json|csv>"}
A single parameter in each pair (mirna,mirna_seq) and (gene,gene_seq) is required.

Result has the same format as database interrogation (/remote/db); please see above.

Examples
wget --post-data='json_request={"queries":[{"run":1,"mirna_seq":"CUAUACGGCCUCCUAGCUUUCC","gene":11965}],"valuesFormat":"percentile","withSequence":false}' http://mirmap.ezlab.org/remote/mirmap